Mission #3 (EH)
Initial
E-mail | Solution |
Excerpt from CHS Slegr | Excerpt From
FA Kumba | Excerpt from MAJ Prophet
CPT Needa,
Following your successful identification of the traitor in our midst, IntOrg
mounted an operation to apprehend the NIF agent. You will no doubt be pleased
to know that the information you provided us with has led to his successful
arrest and detention by IntOrg. However, your work is not yet completed in regards
to this task.
We at EH MedLab have been ordered to run a number of tests on our prisoner,
however he refuses to co-operate. As we are unable to obtain samples for testing
from our detainee, we have been authorised to contact you by IntOrg to request
your assistance in the generation of a genome of the subject. To do this, you
will need to make recourse to advanced Hawkeye technologies, as the Emperor's
Hammer does not currently run to the same levels of biological and technological
advancement as the Genome Fabricator.
You are hereby authorised to contact the prisoner in an attempt to obtain the
information from him that you need to generate a genome code from the Genome
Fabricator. Be warned that this subject is extremely adept at avoiding questioning
and should be approached with all your wits about you.
Once you have obtained the genome code, send it via Hawkeye Transmission to
the EH MedLab (mo@medlab.ehnet.org). We have been instructed to advise you that
should you fail the Emperor's Hammer and its affiliates will deny all knowledge
of your activities.
{Salute}
MO/FA Michael Tolwyn/M-TFC Last Hope
Fleet Medical Officer
The agent had to contact Dervin Malcom Xander, by AIM or HT. AIM was easier of course, and there were some problems with HT, which did end up causing a few agents some problems, but almost everyone who made it till now passed this mission. However, this mission was also the source of inactivity and getting people kicked out from Hawkeye. A note has been made and in Hawkeye II we will try not to give missions of these type. The best way to get the information out of Dervin (played by CPT Falcon) was to be creative, roleplay, or come up with a story. Following are some logs of how a few agents approached the problem. The correct genome to be generated was
CTCACGTATACGCCGGAGCA CCTGATATCTGATTAACTGT TTCCCCTCCTGAATATACCT TTAACCTGCGTTCGTATACG CGTTCGTATACGCCGGAGCA |
OR | AATATTAACCGGAGCACGTA TACGATATCTGACGTATACG TACCTTCCTTAACCTGCCTT TTGACGTTAGCACTGACCTC CCTGACCTTTAACCGGAGCA |
OR | CTCACGTATACGCCGGAGCA CCTGATATCTGATTAACTGT TTCCCCTCCTGTCTGAATAT ACCTTTAACCTGCGTTCGTA TACGCGTTCGTATACGCCGG |
Excerpts:
Brein Randilyn:
Good evening prisoner Dimon
XanManDerv: top o the mornin to ya
Brein Randilyn: <lights a cigarra>
Brein Randilyn: Care for a smoke?
XanManDerv: nah, bad for your health
Brein Randilyn: <chuckles>
XanManDerv: so what brings you to my humble abode, sorry I couldn't clean
it up
Brein Randilyn: Perhaps it is, perhaps it is. So, may I remind you, is
treason.
XanManDerv: eh, live life thas all I gotta say
Brein Randilyn: In that case, why not enjoy a cigarra as opposed to worrying
about what will happen in twenty years.
XanManDerv: true, but then I'd cough and look like an idiot ;-) I gotta
keep up the prisoner get up ya know, can't get urself having a bad image
Brein Randilyn: <laughs warm naturedly>
Brein Randilyn: Well, the women love a nice tall man with with raven
hair and dark skin smoking a cigarra, the smoke rising up around the brim of
their fedora.
XanManDerv: really in that case, I guess both of us don't get women very
much eh?
Brein Randilyn: I do fairly well when I'm on busy. My wife doesn't entertain
me like she once used to. <shrugs>
Brein Randilyn: So, why wouldn't we do very well?
XanManDerv: well I wouldn't do very well cause there are no women in
this cell anyways, but you my friend, well you have a wife, so you don't need
to worry ;-)
XanManDerv: wouldn't want your wife to get angry would you?
Brein Randilyn: Eh, I think she knows that I engage in some fun while
on business.
Brein Randilyn: How about outside the cell? How did you do with the ladies?
Brein Randilyn: <me finishes the first cigarra, saving the cherry
just long enough to light the next cigarra before butting the first out>
XanManDerv: Fine I should say, grew up in a busy place, many to choose
from, but I never really trusted any of em you know? Half of em are just waitin
to stab ya then run if ya know what I mean...
Brein Randilyn: <chuckles with a understanding smile>
Brein Randilyn: Yeah, I understand. My wife is one of those. She keeps
me alive because I get paid well.
XanManDerv: *smiles*
Brein Randilyn: Care to tell me where you grew up so that I don't run
into that problem with a fling trying to suck me dry?
XanManDerv: as I said I grew up in a busy place, the city's name was
Dargonia, famous for its golden wine *grin*
Brein Randilyn: Golden wine? I do hope that is not some sexual reference.
XanManDerv: nah nice drink, now what comes after could be sexual, but
we shan't go into that
Brein Randilyn: You're a funny guy. I like that. <exhales a long puff
of smoke>
XanManDerv: well life don't look too good in this cell ya know? might
as well enjoy it while I breath
Brein Randilyn: Well, why don't you try helping us out some? You scratch
my back, I'll scratch yours, if you'll pardon my cliche.
XanManDerv: and in return I get what?
Brein Randilyn: I can get you a suit, a few dates, some better grub,
a great attorney, and the mercy of select individuals in the government and
the court.
XanManDerv: now I've watched enough holovids to know that the guy who
is promised "freedom" never gets free :-)
XanManDerv: and they just steal his information really
XanManDerv: *sly smile*
Brein Randilyn: I'm not offering freedom.
XanManDerv: ah but see, thats what I want...
Brein Randilyn: Mercy means your head won't roll and you could eventually
see daylight again.
XanManDerv: the suit and the dates come with freedom of course, cause
I'm free....the grub also comes, that is if I get some money, and the attorney,
don't need if I'm free
XanManDerv: this prison is comfortable, and I have to be comfortable
to tell anything
XanManDerv: so freedom really does look good
XanManDerv: maybe if you bargained with more, or tried your coaxing a
little bit more :-)
Brein Randilyn: The prison is comfortable?
XanManDerv: isn't comfortable
Brein Randilyn: ((brb, telephone))
XanManDerv: You are boring me chancellor
XanManDerv: I'm going to sleep
Brein Randilyn: Guard! This prisoner shall have nothing to eat.
Brein Randilyn: His room shall be flooded with light at all hours of
the day!
Brein Randilyn: Remove his bed and his other amenities.
Brein Randilyn: If he can thinking of nothing, he shall receive nothing.
Brein Randilyn: <stands behind the lights shining into the cell>
Have you considered talking yet?
XanManDerv: ah welcome back chancellor
Brein Randilyn: Have you considered talking yet?
XanManDerv: have you considered that without me you'll fail?
XanManDerv: how many times must we go over this chancellor
XanManDerv: no matter what you do to me, I go on because I know that
you WILL fail without me, and that gives me all the satisfaction in the universe!
Brein Randilyn: Does it now?
XanManDerv: ah yes, don't you realize, thats what us NIF agents live
for!
XanManDerv: *smiles*
Brein Randilyn: <lights a cigarra>
XanManDerv: now, how about we discuss what you can do for me, and then,
I'll give you your information
Brein Randilyn: It sounds like you haven't much of anything to live for.
A rather dry life if I may say so.
XanManDerv: lets not get into your family life shall we Chancellor?
Brein Randilyn: What do you need from me?
XanManDerv: freedom...
Brein Randilyn: Well then, give me what I want.
XanManDerv: you must give me your word
XanManDerv: if you don't, you'll die slowly chancellor
Brein Randilyn: I'll die slowly, hmm?
XanManDerv: so how about your wife, how is she doing chancellor?
Brein Randilyn: My wife? She is fine.
Brein Randilyn: So, let us start with your name. What is your name and
rank?
Brein Randilyn: ((brb, knock at the door.))
XanManDerv: ((sorry was awat))
Brein Randilyn: ((s'okay, I'm back))
XanManDerv: Chancellor
XanManDerv: if you give me my freedom
XanManDerv: I will give you what you want
Brein Randilyn: Then you run off without giving the information informing
your government of our investigation.
XanManDerv: well obviously Chancellor I wouldn't get off these prison
grounds without you knowing the information, your getting hasty chancellor and
your wits are getting dulled
XanManDerv: pay attention dear friend!
Brein Randilyn: No, I am simply giving you the respect you are due as
agent. You were able to infiltrate our ranks for some time, you are a very crafty
one, aren't you?
XanManDerv: well not crafty enough as you can see *grins*
Brein Randilyn: Well, to be quite honest, this wouldn't have been possible
were your government not so sloppy with their records.
XanManDerv: thats their problem
XanManDerv: mine is getting out of here
Brein Randilyn: Well, your key is providing me with the information that
I request.
XanManDerv: and I have your word on it?
XanManDerv: a word of an EH chancellor?
XanManDerv: gah
XanManDerv: a word from a bantha would be better!
XanManDerv: hell a whole paragraph would be better! *smiles at his cheesy
joke*
Brein Randilyn: Would you prefer four hour speech?
XanManDerv: not really, you can save me your politics
XanManDerv: I prefer a good bar song opposed to the wretchedness of polictics
Brein Randilyn: I find that ironic you have somehow found yourself involved
in internation politics, since you find it so repulsive.
XanManDerv: all of you are slimes, twisted in your power, behind others
backs, because youd on't have the balls to stand up and fight, so you plot,
and hire men like me to assasinate your own kind, your worse then space pirates!
XanManDerv: you call yourselves heroes of the empire
XanManDerv: and yet you stand there shaky as if newborn infants when
it comes to standing up in a fight
Brein Randilyn: Do you believe that I was always a politician? <laughs>
XanManDerv: I don't care1
XanManDerv: I want FREEDOM!
XanManDerv: open this door and youwill have your answer
XanManDerv: I want to be escorted to a shuttle
XanManDerv: guards can surround me
XanManDerv: thats fine
XanManDerv: fly me to my home planet and I will never plague the EH again!
Brein Randilyn: Fine, I shall arrange for you a shuttle, assuming you
can pilot it.
Brein Randilyn: Tell me what it is that I wish to know.
XanManDerv: I know how to fly my friend
XanManDerv: my planet is Kiffex
XanManDerv: I was born and raised amoung the natives
XanManDerv: in its largest city Dargonia
XanManDerv: smile ball haven, but my kind of home
XanManDerv: and my name....
XanManDerv: *silences and thinks*
XanManDerv: I lose now, either way, forgive me my commanding officers,
may they have mercy on me......my name is Dervin Malcom Xander....
XanManDerv: spy for the NIF
XanManDerv: I did it all for power, and to bring down the "glorious
empire" the one swho stated they were just and worthy to rule, yet slew
all who opposed them behind propaganda that portrayed the emperor as a saint!
and the empire as a church!
XanManDerv: I would like to leave now Chancellor
Brein Randilyn: I take it that your physical attributes are natural,
not altered?
XanManDerv: aye
XanManDerv: all you need is my name chancellor
XanManDerv: that should give you all the info you need
Brein Randilyn: Should it?
XanManDerv: you have my word Chancellor
Brein Randilyn: Humor me this one last time.
XanManDerv: I'm not in the mood Chancellor
XanManDerv: I told you all you need to know
XanManDerv: you don't need to write a biography on me
XanManDerv: the name will bring up tons of documents and records
XanManDerv: anything you need
Brein Randilyn: Very well.
XanManDerv: now I believe you need to close your end of the bargain...
Brein Randilyn: Allow me to make the necessary arrangements.
Brein Randilyn: I shall return shortly.
XanManDerv: Chancellor
Brein Randilyn: Yes?
XanManDerv: *gets closer*
XanManDerv: If you don't hold up your end of the bargain, you will be
sorry...
Brein Randilyn: If I can't communicate with my people in relative privacy,
I can't possibly hold up on my end of the bargain.
XanManDerv: my leader will avenge my death if you trick me
XanManDerv: we are "alike" you could say...
XanManDerv: and nor does he hesitate to kill...
Brein Randilyn: Thank you for the heads up. Patience now. If you behave
in such an agitated manner you'll never be permitted to leave your cell by prison
administration. If they allow it, you'll be sedated.
XanManDerv: then go chancellor
XanManDerv: you have your information
XanManDerv: you've been quite nice to talk to
XanManDerv: and if you could, ask your wife to stop by, I get lonely....
Brein Randilyn: I can imagine.
XanManDerv: good day to you chancellor...
Brein Randilyn: Good day.
XanManDerv: *walks back to his cell FLOOR and lays down*
XanManDerv: chancellor, why are you still here?
XanManDerv: I thought this conversation was over?
XanManDerv: as I said MY NAME IS ALL YOU NEED! IT WILL GIVE YOU EVERYTHING,
now please leave!
Brein Randilyn: Your records run fairly on the incomplete side.
XanManDerv: Chancellor, I won't repeat myself again, my name, is all
you need for your mission....please leave me be....
Brein Randilyn: If you want out, you may wish to cooperate a bit more.
Brein Randilyn: I think you're growing fond of the housing we're providing
you.
XanManDerv: what else do you need to know chancellor I grow weary of
your presence
Brein Randilyn: How about you tell me how tall you are, so that I haven't
need to request a guard measure you.
XanManDerv: I'm 5'8 Chancellor, last time I checked...
Brein Randilyn: Your weight?
XanManDerv: why do you care?
XanManDerv: wanting me to go on a diet too?
Brein Randilyn: For my records
XanManDerv: 190
XanManDerv: though maybe low since you ordered me to starve like a rat!
Brein Randilyn: ((I assume that I would have noticed his hair and eye
color on my own?)) =P
XanManDerv: ((find out :P))
Brein Randilyn: Your hair is naturally that color?
XanManDerv: ((you should have thought of that before :P))
XanManDerv: it is naturally brown, yes...
Brein Randilyn: and your eyes?
XanManDerv: Green Chancellor....
Brein Randilyn: Your vision?
XanManDerv: I'm assuming you can guess my gender :P
XanManDerv: 20/20 Chancellor
Brein Randilyn: Very well.
XanManDerv: is that all you will have of me?
Brein Randilyn: At this time, yes.
Brein Randilyn: I'll process this information and make arrangements for
you.
XanManDerv: meanwhile...
XanManDerv: can I get all my things back?
XanManDerv: and make them more comfortable please
XanManDerv: I get tired of the floor or the raggedy cot I once had
Brein Randilyn: Aye, you may have your amenities back.
Brein Randilyn: <walks off, robes flowing behind him>
XanManDerv: I asked for BETTER amenities chancellor
Brein Randilyn: Ah, so you have. Provide him with a new mattress, some
better food, and perhaps a holovid which can be displayed from the hall.
CONGRATULATIONS!!!
Lieutenant Commander Dervin Malcom Xander, You are the now the OWNER of a BRAND NEW Seinar Fleet Systems GAT-12p Skipray Blastboat!! As the lucky Winner in the Gemini Galacticon Mega-Giveaway Contest, YOU have been selected from millions of pilots as one of our lucky Grand Prize Winners! This is not a standard Model Skipray; while the basic armament is the same as the common GAT-12j Blastboat, this is the "personalized" version (hence the GAT-12p).
In order to process your Grand Prize, and to have it personalized for you at the nearest Sienar Fleet Systems manufacturing plant, we need the following information:
1. Your complete Name (if it is different than the pilot name you were selected
as). This is so that we can craft a personalized gold-plated nameplate for you
and place it inside the cabin of the Blastboat.
2. Your planet of origin; Since the Skipray has quite a lofty cabin (it typically requires a crew of four, but this model sports an upgraded AI Computer system, thus reducing the need to one pilot), we will furnish carpeting with your Planet's planetary seal in the carpet design, as well as contact the leaders of your world to inform them that a native of their world has won such a WONDERFUL Prize!
3. Your hair and eye color, so that we can match the interior decorating to something that suits a pilot's individual tastes.
4. Your height and weight; this is so we can properly mold the personalized pilot's chair to fit your body in a very comfortable fashion.
5. Your gender, so that we can install the...*ahem*...proper "facilities" aboard your new Blastboat.
7. And finally, whether or not you wear glasses, so we can install the right model of Computer Targeting and Imaging System (CTIS), as there exist models for those with poor vision, and those who have superior vision.
If you can get us this information as quickly as possible, we can begin the
processing of your winning prize, and make sure the appropiate parts arrive
at a Sienar Fleet Systems facility nearest to you. Once assembly is completed,
and appropiate flight dynamics testing has been finished, you will be contacted
and given a claim ticket which is required in order to claim your brand new
GAT-12p Skipray Blastboat!
Further information regarding the Skipray Blastboat, Model GAT-12p is listed below for your conveinence.
Sincerely,
Kumba Qel'Gala Urashima
President & CEO
Gemini Galacticon Corporation
-----------------------------
Name: GAT-12p Skipray Blastboat
Manufacturer: Sienar Fleet Systems
Craft type: Mid-sized Anti-Defense
and System Patrol craft
Used by: Empire
Crew: 1 (GAT-12j model requires 4)
Power System: Sarylcorp
ViX Multiflux Reactor
Hyperdrive: Yes
Weapons:
2 Senko Systems 5000 "Tru-Lok" Laser Cannons
3 Mendarn Arms Dar-2 Medium Ion Cannons
1 Dymek HM-6 Concussion Missile Launcher (Max Load 18)
1 Arakyd Flex Tube Proton Torpedo Launcher (Max Load 12)
Speed: 77 MGLT
Acceleration: 11 MGLT sec.
Manuverability: 87 DPF
Roll: 22
Pitch: 9
Hull: 85 RU
Shield Generator: Yes
Shield Power: 135 SBD
Length: 25 meters
Passengers: None
Cargo Capacity: 20 Metric tons
Consumables: 1 Month
From MAJ Prophet:
ProphetEH: hello
XanManDerv: *spits at you*
XanManDerv: another one of you?
ProphetEH: Yup
XanManDerv: what do you want agent?
XanManDerv: I grow tired of the EH's pitiful games
ProphetEH: Lets start out with some basic questions
ProphetEH: First, what do you call that ugly hair color of yours
XanManDerv: a color better then yours eh pig
ProphetEH: really, and what makes you say that
XanManDerv: this cell...what is it you need agent?
ProphetEH: Why don't you tell me where you are from
ProphetEH: Hello? Listen, you tell me what I want to know and I can make this
easier for you
ProphetEH: If you want I can get you some glasses to help you see better
ProphetEH: hello?
ProphetEH: hello?
ProphetEH: Hey, Xavier you alive?
ProphetEH: Fine or we could sit here staring at each other...
ProphetEH: s'ok
ProphetEH: So, where were we
ProphetEH: So where you from?
XanManDerv: well Major your quite the talker
ProphetEH: Thanks, I try but don't avoid the question...
ProphetEH: I'm curious where you come from...
XanManDerv: a nice city called Dargonia
XanManDerv: famous for its Golden Wine
XanManDerv: tell me major, are you married?
ProphetEH: No actually... Although I may have to try that wine on a date...
But tell me, I've heard of Dargonia before but can't place it. what planet is
it on?
XanManDerv: and Major, is there anything that you would want, ANYTHING? that
would make you betray your beloved EH?
ProphetEH: Sure, you're answering my questions :-)
XanManDerv: really
XanManDerv: do you know why I betrayed the EH major?
ProphetEH: why?
XanManDerv: because I saw past the propaganda of the Empire! The glorious empire,
while in the background it slew all creatures that dare oppose it!
XanManDerv: and for power, of course....
XanManDerv: power is everything major
XanManDerv: of all people with a rank of Major you should know that
XanManDerv: as you were saying major?
ProphetEH: Thats true power; is important. but you missed some things... Flying
for instance. We're both pilots and I think for most of us flying is power.
ProphetEH: Look, I can't say you're completely wrong in the search for power
so as fellow pilots lets help each other
ProphetEH: You seem to be squinting; do you want some glasses?
XanManDerv: I don't think thats important now is it major?
ProphetEH: I'm just trying to be helpful
ProphetEH: I need my glasses otherwise I would fly into a building when I land,
I can understand the disorientation it might cause
XanManDerv: being helpful would to free me major
XanManDerv: I'm just "like" my leader, and we both have bad tempers
XanManDerv: he doesn't hesitate to kill my friend
ProphetEH: Neither do I
XanManDerv: yes, but see, if you kill me, you fail my friend
XanManDerv: go ahead, I see your blaster, use it
XanManDerv: kill me major
XanManDerv: and u will fail, and my mission will be complete
ProphetEH: And what mission is that?
XanManDerv: the mission given to me by my CO
ProphetEH: Which is what
XanManDerv: none of your concern
XanManDerv: *grins at his joke*
ProphetEH: Look Xavier, I want to help but you've got to give a little here.
I won't kill you and my friends are pretty experienced in torture. answer my
questions and escape some undue pain
XanManDerv: you torture me and you'll never get anything...
ProphetEH: True, but for my friends, torture is it's own reward
ProphetEH: Now, just tell me about your homeworld
ProphetEH: what's it like there,
XanManDerv: a big city
XanManDerv: smile ball haven!
ProphetEH: smile ball? whats that?
XanManDerv: slime
XanManDerv: this cell isn't exactly a chit chatty place
ProphetEH: Hmm, sorry as you've noticed I like to talk... So how did you get
passed flight restrictions.. you seem to tall for that
XanManDerv: my secret
ProphetEH: Look kid, tell me where you're from and maybe I can get some messages
to your loved ones
XanManDerv: I'm no kid to you major, I've seen more combat and death then you
will ever dream of....
XanManDerv: and I have no loved ones...
ProphetEH: No family, no friends... Tell me what planet your from, you must
have so people who would want to know you're alive
ProphetEH: *some not so
XanManDerv: I'm from a far planet
XanManDerv: none of your concern major
ProphetEH: Hell, at least tell me where you're from so I can get some of that
Golden Wine of yours
XanManDerv: I can send you some when I'm free from this stinking jail cell....
ProphetEH: In case you don't go out why don't you give me a hint at least
XanManDerv: a planet with Dargonia as its main city
ProphetEH: Its not Dathomir is it? You're not one of those female force witches
are you?
XanManDerv: oh how'd you guess major, your a bright one aren't you? Now smart
guy if I were a witch you think you'd still be living?
ProphetEH: Well you look male to me, but Dargonia sounds like a Dathomir city
XanManDerv: Major I can see your not interrogating officer, you assume too much
with too little information...
ProphetEH: No, as I've said I'm a pilot just like u
XanManDerv: then why would they send a mere pilot to do a real man's job?
ProphetEH: *whisper* because I work for the Vast Empire. I'm trying to get some
background on you and see if you have anything that might be useful to us agains
the Eh
ProphetEH: If you tell me some things about yourself, we may be able to strick
a deal but only if my superiors know certain things about you
ProphetEH: If you give us reason to trust you, we may be able to return you
to the NIF, but you have to help me here otherwise you'll be stuck in this lousy
EH shit for a long time
XanManDerv: Major
XanManDerv: I'm not your friend, and will do anything to turn on you
XanManDerv: if you value your life, never tell me this crap again
ProphetEH: Didn't I date your sister once. She looked like blonde hair, blue
eyes, five foot eight, 130 pounds... I think she said she was from Dargonia
ProphetEH: Look, why don't we have this talk again tommarrow when we've cooled
down. Have some food (Drugged preferably) and then we'll talk.
XanManDerv: aye major
XanManDerv: that will be good
XanManDerv: I look foward to speaking to you tomorrow
XanManDerv: *lays back down on his cot and closes his eyes*
XanManDerv: goodbye major....
ProphetEH: hello again
XanManDerv: ah major welcome back to my humble abode
ProphetEH: how r u doing
XanManDerv: good if you call living in a cell dandy!
ProphetEH: So I was wondering if you were willing to talk today about your apperance...
is this the same as your nif appearance?
XanManDerv: the only way I'll talk is if I get freedom, thats all that is important
to me now major
ProphetEH: So tell me what I want to know and then we can talk about your release
ProphetEH: Where is dargonia?
XanManDerv: You think I'll trust you that quickly major?
XanManDerv: *laughs*
ProphetEH: Well, how can I earn your trust on this?
ProphetEH: You give me something and I will give you something. When I have
what I want, I try and get you released.
XanManDerv: no, not try, I wan do
ProphetEH: Ok, describe yourself and where dargonia is and I will get them to
let you go free
XanManDerv: as I said Major, I don't crumble that easily
XanManDerv: and I still don't trust you
XanManDerv: how will a mere Major get me free?
ProphetEH: How can I earn your trust?
XanManDerv: you let me out of this cell, and escorted outside the prison complex
and I will tell you all you need to know, bring as many guards as you want
ProphetEH: Ok, first give me planet of origin and certain dicriptions about
yourself and then before you tell me the rest I will take you outside
XanManDerv: no major, you know what I want
ProphetEH: while I think of your offer would you like some of that golden wine...
I found out we had some on the base
ProphetEH: Ok, tell me where you are from first and then I will take you outside
XanManDerv: major, there is nothing to deal with here
XanManDerv: without me your mission is nil
XanManDerv: take me outside at once your time grows short
ProphetEH: Fine, lets go
ProphetEH: Now tell me everything there is to know already
XanManDerv: arrange a shuttle to pick me up please
XanManDerv: I don't know that you won't shoot me
XanManDerv: major think
ProphetEH: What! we are just walking outside... Tell me what I want to know
XanManDerv: oh no major
XanManDerv: I want freedom
XanManDerv: I said take me out of this prison
XanManDerv: now arrange a shuttle
XanManDerv: or your info won't come
XanManDerv: have it your way
XanManDerv: either way you lose
XanManDerv: that is, if you fail to cooperate
ProphetEH: How about this, 10 yards from here is a shuttle, tell me what I want
to know and then you can go to the shuttle. Look at me I'm unarmed I won't shoot
you
XanManDerv: I don't see the shuttle
XanManDerv: nor hear it
ProphetEH: What, you need glasses? It's a standard small transport right in
front of you
ProphetEH: Fine, here is your damn shuttle. Its right there in front of you
ProphetEH: now please tell me what I want to know
XanManDerv: *steps onto the ramp of the shuttle escorted by guards and yells
back* my planet is kiffex
ProphetEH: How tall are you, and how much do u way
XanManDerv: 5'8 and 190 lbs
ProphetEH: eye and hair color?
ProphetEH: do u need glasses?
XanManDerv: eyes are green
XanManDerv: hair is brown major!
XanManDerv: my full name major is Dervin Malcom Xander!
XanManDerv: *salutes as the shuttle takes off*