Mission #4 (NIF)
Initial
E-mail | Solution | Excerpt from SBM
Sterling |
From SA Astatine
CPT Needa,
Now that you have completed your third mission for us, and so earned a measure
of trust, it is time for you to take on your hardest task on our behalf to date.
It is part of the NIF's plan to create a clone of a member of the Emperor's
Hammer. The reasons for this operation will become clear to you later. For now,
this is all that you need to know. As this part of our project is highly classified,
you will of course understand that should you leak any information concerning
it, you will be immediately terminated. We are confident that you will not let
us down.
As for your task, you will remember gathering a limited amount of information
about a target from the Emperor's Hammer last mission. This mission is in the
same vein, but the information you retrieve about <insert rank and name
and position> must be much more detailed, as you will be required to
generate a genome using the Hawkeye Genome Fabricator. This genome will be sent
in a Hawkeye Transmission to clonelabs@nif.net so that we may begin the cloning
process.
To generate an accurate genome, you will need to recover information on the
target's hair colour, eye colour, gender, height, weight, and vision impairments
(if any). Of course, all of this information, including name and planet from
the previous mission is in character only. You may only question your target
on this if absolutely necessary, and should try not ask more than one or two
questions, as too many may arouse the target's suspicion. Feel free to extract
this information any way you see fit. Be creative. Exercise extreme caution
- this mission is highly sensitive.
{Salute}
OPS/RA Cedric/ISD Emperor's Will
LV/SCx2/CC/DCMx8/DFO [CORE]
NIF Operations Director
Notes:
For where it says "insert
rank..." simply either BGCOM/VA Mell or SO/FA Stalker5 was inserted.
This was a lot harder of a mission. It required actually gathering information about the target without arousing their suspicion. Many people were creative in how they approached the target. Some people didn't even approach the target at all, but rather relied on other sources, such as people who met the target. In the end, they had to submit the genome generated from the info they gathered. The correct genome was:
For VA Mell:
CGATCGTACTGTCTGTCTGA
CGTACTGTCTGTCTGACGTA
CTGTCTGTCTGACGTACTGT
CTGTCTGACGTACTGTCTGT
CTGACGTACTGTCTGTCTGA
For FA Stalker5:
GGTGCCTTTTAACTGTTAAC
CGTATACGTCTATACCCCTT
TTAACTGTTAACCGTATACG
TCTATACCCCTTTTAACTGT
TAACCGTATACGTCTATACC
Excerpts:
[15:41] (Sterling):
heya, sir. Sorry to bother you, but I've got two things. First, I'm LCM Chronos
(#487) and I'll be transfering to Spear Squad in your battlegroup. Second, I'm
writing a last minute Andevia fic and I'm asking all my superiors (you, Zadash
and my CM) for some information so I won't portray you improperly.
[15:41] (`M): ok.
[15:42] (`M): when's the transfer coming in?
[15:42] (Sterling): you're INPR says you're a vampire and you don't like
light, so I'm assuming you have super strength as well../
[15:42] (Sterling): I mailed Pri this morning
[15:43] (`M): i have some increased attributes.
[15:48] (Sterling): um, okay um what do you look like, hair/eye color,
height, weight & what's your temperament?
[15:48] (Sterling): (oh do you know if Neko or Zadash have IRC?)
[15:49] (`M): Lohr is on IRC frequently.
[15:49] (`M): :P
[15:50] (`M): temperent is easy: Drunk :P
[15:51] (Sterling): heh
[15:51] (`M): weight... tricky one, even i don't know!
[15:51] (`M): hair and eyes are both dark :)
[15:52] (`M): typically vampirian :P
[15:53] (Sterling): heh, so tall, lean and strong :P
[15:53] (`M): check the IA for some photo's of me :P
[15:55] (Sterling): k, thx. oh and what's VA Zadash's IRC nick?
[15:55] (`M): Lohr or VA_Zadash
[15:56] (Sterling): great, thx
[15:58] (`M): make sure you send me the fiction so i can read it! :)
[15:59] (Sterling): np
Astat1ne: hey, Ciara
mentioned something about a story she was writing involving you...she said she
forgot to get a detail off you...she asked me to get it off you, since I'm online
a lot more and all that
SJRRoth: hrm?
Astat1ne: yeah, she said she needed your weight
SJRRoth: Um, I told her... not really heavy, but not really slim
Astat1ne: yeah, but she said she needed the exact weight for some reason
Astat1ne: you know how women are :P